ID: 953349783_953349792

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 953349783 953349792
Species Human (GRCh38) Human (GRCh38)
Location 3:42206871-42206893 3:42206906-42206928
Sequence CCCATCCTTGGGAGCGGGTGAGG GGGGCAGCCTGTTGAACAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95} {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!