ID: 953364947_953364953

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 953364947 953364953
Species Human (GRCh38) Human (GRCh38)
Location 3:42336402-42336424 3:42336440-42336462
Sequence CCAGATGAACAAATATAGGTCCT CTTTCTATATAGAAGGAGGCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!