ID: 953390492_953390496

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 953390492 953390496
Species Human (GRCh38) Human (GRCh38)
Location 3:42531102-42531124 3:42531116-42531138
Sequence CCAGGACAAGTCCCTCAGGTTGC TCAGGTTGCAGCTGCACCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 113} {0: 1, 1: 0, 2: 4, 3: 10, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!