ID: 953471556_953471561

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 953471556 953471561
Species Human (GRCh38) Human (GRCh38)
Location 3:43170997-43171019 3:43171033-43171055
Sequence CCAGCCACCAACACTCTTCAGTC ACAAACATCAACAGACAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 212} {0: 1, 1: 0, 2: 1, 3: 15, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!