|
Left Crispr |
Right Crispr |
| Crispr ID |
953617682 |
953617686 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:44506794-44506816
|
3:44506825-44506847
|
| Sequence |
CCTCCGTCTCCTGGATTCAAGTG |
GCCTCAGCCTTCCAAGTAGCTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
{0: 2677, 1: 88944, 2: 199316, 3: 238775, 4: 231215} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|