ID: 953617682_953617688

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 953617682 953617688
Species Human (GRCh38) Human (GRCh38)
Location 3:44506794-44506816 3:44506826-44506848
Sequence CCTCCGTCTCCTGGATTCAAGTG CCTCAGCCTTCCAAGTAGCTGGG
Strand - +
Off-target summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} {0: 3527, 1: 101662, 2: 212141, 3: 250946, 4: 264986}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!