|
Left Crispr |
Right Crispr |
Crispr ID |
953617682 |
953617690 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:44506794-44506816
|
3:44506834-44506856
|
Sequence |
CCTCCGTCTCCTGGATTCAAGTG |
TTCCAAGTAGCTGGGATTACAGG |
Strand |
- |
+ |
Off-target summary |
{0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} |
{0: 1904, 1: 54917, 2: 152010, 3: 260731, 4: 534754} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|