ID: 953617682_953617690

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 953617682 953617690
Species Human (GRCh38) Human (GRCh38)
Location 3:44506794-44506816 3:44506834-44506856
Sequence CCTCCGTCTCCTGGATTCAAGTG TTCCAAGTAGCTGGGATTACAGG
Strand - +
Off-target summary {0: 22, 1: 910, 2: 11219, 3: 45370, 4: 97042} {0: 1904, 1: 54917, 2: 152010, 3: 260731, 4: 534754}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!