ID: 953861741_953861750

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 953861741 953861750
Species Human (GRCh38) Human (GRCh38)
Location 3:46550168-46550190 3:46550219-46550241
Sequence CCACTTACCATCTGTGTGAACTT CATCTGCAAATTAGGGATGGTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 105, 3: 610, 4: 2311} {0: 1, 1: 0, 2: 2, 3: 27, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!