ID: 954089973_954089988

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954089973 954089988
Species Human (GRCh38) Human (GRCh38)
Location 3:48276584-48276606 3:48276634-48276656
Sequence CCTCTGCCCCTTCAGAGAAGCCA GGTACCAAGGCACCCCAAGTTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 5, 3: 30, 4: 337} {0: 1, 1: 1, 2: 2, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!