ID: 954089982_954089989

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 954089982 954089989
Species Human (GRCh38) Human (GRCh38)
Location 3:48276612-48276634 3:48276635-48276657
Sequence CCCGTGCCTTGCTTATGGCGGGG GTACCAAGGCACCCCAAGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 72} {0: 1, 1: 1, 2: 3, 3: 6, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!