ID: 954108709_954108718

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 954108709 954108718
Species Human (GRCh38) Human (GRCh38)
Location 3:48422626-48422648 3:48422660-48422682
Sequence CCACCCAGTCCTGGGGAGAGGAG TCTCCTGGCCCAGGGGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 666} {0: 1, 1: 0, 2: 5, 3: 38, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!