ID: 954108709_954108723

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 954108709 954108723
Species Human (GRCh38) Human (GRCh38)
Location 3:48422626-48422648 3:48422676-48422698
Sequence CCACCCAGTCCTGGGGAGAGGAG TCACAGGGATAGCTTAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 55, 4: 666} {0: 1, 1: 0, 2: 0, 3: 30, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!