ID: 954150145_954150150

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 954150145 954150150
Species Human (GRCh38) Human (GRCh38)
Location 3:48653222-48653244 3:48653237-48653259
Sequence CCCCATGTGGGCTGGGACTTGGA GACTTGGAGGTGAGATCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 224} {0: 1, 1: 0, 2: 2, 3: 37, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!