|
Left Crispr |
Right Crispr |
| Crispr ID |
954159265 |
954159273 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:48708793-48708815
|
3:48708843-48708865
|
| Sequence |
CCCGTGTGGTGGCTCACACACGT |
CAGGATGACTGTTTGAGCCCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 213, 3: 962, 4: 2866} |
{0: 1, 1: 106, 2: 1683, 3: 10046, 4: 33082} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|