|
Left Crispr |
Right Crispr |
| Crispr ID |
954233070 |
954233082 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:49233783-49233805
|
3:49233832-49233854
|
| Sequence |
CCATGATGCCCATGCTGAAGGTT |
AACACTTGGCCCACCGAGGGCGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 20, 1: 42, 2: 41, 3: 113, 4: 764} |
{0: 1, 1: 6, 2: 216, 3: 230, 4: 215} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|