ID: 954233073_954233076

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 954233073 954233076
Species Human (GRCh38) Human (GRCh38)
Location 3:49233791-49233813 3:49233804-49233826
Sequence CCCATGCTGAAGGTTGTGGGTTT TTGTGGGTTTACCAGAATGAGGG
Strand - +
Off-target summary {0: 28, 1: 73, 2: 77, 3: 138, 4: 1941} {0: 108, 1: 177, 2: 350, 3: 219, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!