|
Left Crispr |
Right Crispr |
| Crispr ID |
954233073 |
954233079 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
3:49233791-49233813
|
3:49233818-49233840
|
| Sequence |
CCCATGCTGAAGGTTGTGGGTTT |
GAATGAGGGCAAGGAACACTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 28, 1: 73, 2: 77, 3: 138, 4: 1941} |
{0: 13, 1: 498, 2: 338, 3: 138, 4: 254} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|