|
Left Crispr |
Right Crispr |
Crispr ID |
954233074 |
954233080 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:49233792-49233814
|
3:49233828-49233850
|
Sequence |
CCATGCTGAAGGTTGTGGGTTTA |
AAGGAACACTTGGCCCACCGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 29, 1: 66, 2: 79, 3: 119, 4: 1717} |
{0: 1, 1: 7, 2: 330, 3: 330, 4: 313} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|