ID: 954233078_954233082

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 954233078 954233082
Species Human (GRCh38) Human (GRCh38)
Location 3:49233815-49233837 3:49233832-49233854
Sequence CCAGAATGAGGGCAAGGAACACT AACACTTGGCCCACCGAGGGCGG
Strand - +
Off-target summary {0: 6, 1: 256, 2: 168, 3: 57, 4: 151} {0: 1, 1: 6, 2: 216, 3: 230, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!