ID: 954322111_954322119

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 954322111 954322119
Species Human (GRCh38) Human (GRCh38)
Location 3:49839367-49839389 3:49839410-49839432
Sequence CCAATCCTTCTGCCTCGTGGCTC GCACGCACTCCTGGCACTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 176} {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!