ID: 954322112_954322119

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 954322112 954322119
Species Human (GRCh38) Human (GRCh38)
Location 3:49839372-49839394 3:49839410-49839432
Sequence CCTTCTGCCTCGTGGCTCCCTCT GCACGCACTCCTGGCACTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 454} {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!