ID: 954702260_954702268

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 954702260 954702268
Species Human (GRCh38) Human (GRCh38)
Location 3:52456421-52456443 3:52456446-52456468
Sequence CCCACACACACTTCTAAGCTATG GGAGACAGAGGACAAATAGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174} {0: 1, 1: 0, 2: 0, 3: 31, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!