ID: 954924838_954924841

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 954924838 954924841
Species Human (GRCh38) Human (GRCh38)
Location 3:54224454-54224476 3:54224489-54224511
Sequence CCAGCTTGACCACAGACGGGTGA ACTACAATGTTACAACACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 97} {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!