ID: 954948566_954948572

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 954948566 954948572
Species Human (GRCh38) Human (GRCh38)
Location 3:54448457-54448479 3:54448480-54448502
Sequence CCTCCCCTGGGTTATATTCCCAT CAGTTCCCCCAAACGAAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 141} {0: 1, 1: 0, 2: 0, 3: 2, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!