ID: 955064673_955064678

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 955064673 955064678
Species Human (GRCh38) Human (GRCh38)
Location 3:55524172-55524194 3:55524185-55524207
Sequence CCCCCTCTATACTCGCCCATACA CGCCCATACAGCAGAGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58} {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!