ID: 955064673_955064681

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 955064673 955064681
Species Human (GRCh38) Human (GRCh38)
Location 3:55524172-55524194 3:55524192-55524214
Sequence CCCCCTCTATACTCGCCCATACA ACAGCAGAGAGCTGGGCAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58} {0: 1, 1: 1, 2: 4, 3: 24, 4: 299}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!