ID: 955377648_955377656

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 955377648 955377656
Species Human (GRCh38) Human (GRCh38)
Location 3:58411426-58411448 3:58411474-58411496
Sequence CCTTGGGGGTGAATGCTGTTGTG CCTATCTTCGCCATGGTTGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 287} {0: 1, 1: 0, 2: 0, 3: 2, 4: 37}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!