ID: 955487980_955487982

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 955487980 955487982
Species Human (GRCh38) Human (GRCh38)
Location 3:59454053-59454075 3:59454070-59454092
Sequence CCAAGAGAGTGGCAATACAGTTA CAGTTAAATCTTGAAGAGGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 17, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!