ID: 955751358_955751362

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 955751358 955751362
Species Human (GRCh38) Human (GRCh38)
Location 3:62188050-62188072 3:62188081-62188103
Sequence CCCATGAGTTGTTGAGTAAAACA AAAAATTCTAGGGCCAGTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 176} {0: 1, 1: 0, 2: 9, 3: 103, 4: 758}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!