ID: 955909434_955909437

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 955909434 955909437
Species Human (GRCh38) Human (GRCh38)
Location 3:63845093-63845115 3:63845121-63845143
Sequence CCTTCTTTTCTGGGGGTGGGGGG TCTCCTTCATGTAGCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 14, 3: 75, 4: 690} {0: 1, 1: 0, 2: 2, 3: 16, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!