ID: 955932624_955932628

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 955932624 955932628
Species Human (GRCh38) Human (GRCh38)
Location 3:64072899-64072921 3:64072921-64072943
Sequence CCCTTTTTTTCCTCCTTTATTCT TTATACAGAATGAACTTTCTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!