ID: 956097876_956097884

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 956097876 956097884
Species Human (GRCh38) Human (GRCh38)
Location 3:65736597-65736619 3:65736626-65736648
Sequence CCTCCAGAGACCGAAGACCCAGA GAGCTCCAATGTCCAAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 141} {0: 7, 1: 27, 2: 69, 3: 192, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!