ID: 956573515_956573518

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 956573515 956573518
Species Human (GRCh38) Human (GRCh38)
Location 3:70724804-70724826 3:70724846-70724868
Sequence CCATTTTGATTTGATTTCTGTAT TTGTTTCACTCTAATGCATGTGG
Strand - +
Off-target summary {0: 14, 1: 406, 2: 1341, 3: 8620, 4: 17976} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!