ID: 956606965_956606973

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 956606965 956606973
Species Human (GRCh38) Human (GRCh38)
Location 3:71082945-71082967 3:71082997-71083019
Sequence CCTCCATCTTCTAAAAGGAACCT CTGGATCTACGTGGTTTTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 194} {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!