ID: 956654995_956655000

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 956654995 956655000
Species Human (GRCh38) Human (GRCh38)
Location 3:71540871-71540893 3:71540907-71540929
Sequence CCAAACACCAATGAAAGATTAGA TTTAGGACCACAAGTTAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 205} {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!