ID: 956675829_956675834

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 956675829 956675834
Species Human (GRCh38) Human (GRCh38)
Location 3:71731052-71731074 3:71731071-71731093
Sequence CCAGCCACTCCCAGTCCTCACTC ACTCCTGAGTCAGCCAAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 509} {0: 1, 1: 0, 2: 2, 3: 30, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!