ID: 956854166_956854175

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 956854166 956854175
Species Human (GRCh38) Human (GRCh38)
Location 3:73259561-73259583 3:73259594-73259616
Sequence CCTGGAAATCCCTTCTAGCATCC ACAGGAAGACAAAGTTGGCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 43, 4: 352}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!