ID: 957118391_957118395

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 957118391 957118395
Species Human (GRCh38) Human (GRCh38)
Location 3:76057146-76057168 3:76057178-76057200
Sequence CCTTCTAAGACCTTTTATTTATA ATCTGATACTAGGCGTATGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 390} {0: 1, 1: 0, 2: 0, 3: 0, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!