ID: 957332998_957332999

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 957332998 957332999
Species Human (GRCh38) Human (GRCh38)
Location 3:78790471-78790493 3:78790516-78790538
Sequence CCAGTTATACTCTCTTAGTTATT TATTCAATACCATCACCCTGTGG
Strand - +
Off-target summary {0: 4, 1: 109, 2: 564, 3: 1103, 4: 1445} {0: 1, 1: 0, 2: 1, 3: 17, 4: 202}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!