ID: 957870541_957870546

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 957870541 957870546
Species Human (GRCh38) Human (GRCh38)
Location 3:86085635-86085657 3:86085682-86085704
Sequence CCTGGAAAACATGCTTTAGAGTC CTACCTTGAAGCTGCTATGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!