ID: 958450766_958450767

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 958450766 958450767
Species Human (GRCh38) Human (GRCh38)
Location 3:94269625-94269647 3:94269642-94269664
Sequence CCGTGTCTTCATGGAAGGACTGA GACTGAATACCATCACTAGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 2, 4: 56}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!