ID: 958616308_958616309

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 958616308 958616309
Species Human (GRCh38) Human (GRCh38)
Location 3:96497159-96497181 3:96497174-96497196
Sequence CCGAGCTCATAGTTCTAATTAAA TAATTAAAATTTTACCCCTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 36, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!