ID: 958829147_958829153

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 958829147 958829153
Species Human (GRCh38) Human (GRCh38)
Location 3:99066649-99066671 3:99066680-99066702
Sequence CCCATTTTTAAAAGCCTCACACA CTCTTTCATGGCATCTTCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 30, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!