ID: 959132924_959132926

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 959132924 959132926
Species Human (GRCh38) Human (GRCh38)
Location 3:102380362-102380384 3:102380399-102380421
Sequence CCAGCTCTGGCTTCTTGTGGGAA CTAGAAGCAAAAGTGGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 213} {0: 1, 1: 0, 2: 0, 3: 18, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!