ID: 959419581_959419598

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959419581 959419598
Species Human (GRCh38) Human (GRCh38)
Location 3:106112612-106112634 3:106112665-106112687
Sequence CCAAGGCAGGCGGCTGCTCCTTG TCCAGCCGCTGCCTCCCCGGCGG
Strand - +
Off-target summary {0: 68, 1: 10, 2: 0, 3: 31, 4: 190} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!