ID: 959419588_959419598

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 959419588 959419598
Species Human (GRCh38) Human (GRCh38)
Location 3:106112635-106112657 3:106112665-106112687
Sequence CCCTCGGGCCCCGCGGGGCCCGT TCCAGCCGCTGCCTCCCCGGCGG
Strand - +
Off-target summary {0: 61, 1: 11, 2: 0, 3: 3, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!