ID: 959419590_959419596

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 959419590 959419596
Species Human (GRCh38) Human (GRCh38)
Location 3:106112643-106112665 3:106112662-106112684
Sequence CCCCGCGGGGCCCGTCCGCTCCT TCCTCCAGCCGCTGCCTCCCCGG
Strand - +
Off-target summary {0: 62, 1: 8, 2: 1, 3: 13, 4: 130} {0: 68, 1: 4, 2: 46, 3: 1012, 4: 14027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!