ID: 959419591_959419596

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 959419591 959419596
Species Human (GRCh38) Human (GRCh38)
Location 3:106112644-106112666 3:106112662-106112684
Sequence CCCGCGGGGCCCGTCCGCTCCTC TCCTCCAGCCGCTGCCTCCCCGG
Strand - +
Off-target summary {0: 67, 1: 6, 2: 1, 3: 18, 4: 221} {0: 68, 1: 4, 2: 46, 3: 1012, 4: 14027}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!