ID: 959419594_959419605

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 959419594 959419605
Species Human (GRCh38) Human (GRCh38)
Location 3:106112654-106112676 3:106112680-106112702
Sequence CCGTCCGCTCCTCCAGCCGCTGC CCCGGCGGCGCTCGCCGGCGCGG
Strand - +
Off-target summary {0: 70, 1: 0, 2: 5, 3: 61, 4: 657} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!