ID: 959419597_959419607

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 959419597 959419607
Species Human (GRCh38) Human (GRCh38)
Location 3:106112663-106112685 3:106112683-106112705
Sequence CCTCCAGCCGCTGCCTCCCCGGC GGCGGCGCTCGCCGGCGCGGCGG
Strand - +
Off-target summary No data {0: 46, 1: 12, 2: 3, 3: 33, 4: 309}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!